Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3,... Tender

CENTRAL UNIVERSITY OF HIMACHAL PRADESH has floated a tender for Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3, Qty: 1 No, (BOQ Item #85). The project location is Kangra, Himachal Pradesh, India. The reference number is - and it is closing on 16 Apr 2025. Suppliers can request Register free of cost to get the complete Tender details and download the document.

Procurement Summary

State : Himachal Pradesh

Summary : Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3, Qty: 1 No, (BOQ Item #85)

Deadline : 16 Apr 2025

Other Information

Notice Type : Tender

TOT Ref.No.: 116806650

Document Ref. No. : Login to see detail

Competition : NCB

Financier : Self Financed

Purchaser Ownership : Public

Document Fees : Refer Document

Tender Value : Refer Document

EMD : Refer Document

Purchaser's Detail

Name : Login to see details

Address : Login to see details

Email : Login to see details

  Login to see details

Documents

 Tender Notice

Bid_Document_7683330.pdf

Specification_Document.pdf

BOQ_Document.csv


Neshcap